Sotirimod (R850)

Validation of Blood Pressure Measurement Using a Smartwatch in Patients With Parkinson's Disease

Objectives: We aimed to validate the accuracy of blood pressure (BP) measurement using a smartwatch in patients with Parkinson's disease (PD). Materials and Methods: We compared 168 pairs of BP (n = 56) measurements acquired by a smartwatch (SM-R850) with those measured by a sphygmomanometer (reference device). Results: Differences between the smartwatch BP and reference BP measurements were compared. The mean and standard deviation of the differences systolic BP (SBP) and diastolic BP (DBP), measured by smartwatch and reference device, fulfilled both criterion 1 (0.4 ± 4.6 and 1.1 ± 4.5 mm Hg for DBP and SBP, respectively) and criterion 2 (0.2 ± 2.5 and 0.9 ± 2.4 mm Hg for DBP and SBP, respectively) of the BP validation criterion of the International Organization for Standardization. Conclusion: BP measurement using a smartwatch with a photoplethysmography sensor is an accurate and reliable method in patients with PD.

A graduate student's worth

Sampson et al. discuss the economic and societal value of graduate education, in particular in the USA.

Zygosity determination in hairless mice by PCR based on Hr(hr) gene analysis

We analyzed the Hr gene of a hairless mouse strain of unknown origin (HR strain, http://animal.nibio.go.jp/e_hr.html) to determine whether the strain shares a mutation with other hairless strains, such as HRS/J and Skh:HR-1, both of which have an Hr(hr) allele. Using PCR with multiple pairs of primers designed to amplify multiple overlapping regions covering the entire Hr gene, we found an insertion mutation in intron 6 of mutant Hr genes in HR mice. The DNA sequence flanking the mutation indicated that the mutation in HR mice was the same as that of Hr(hr) in the HRS/J strain. Based on the sequence, we developed a genotyping method using PCR to determine zygosities. Three primers were designed: S776 (GGTCTCGCTGGTCCTTGA), S607 (TCTGGAACCAGAGTGACAGACAGCTA), and R850 (TGGGCCACCATGGCCAGATTTAACACA). The S776 and R850 primers detected the Hr(hr) allele (275-bp amplicon), and S607 and R850 identified the wild-type Hr allele (244-bp amplicon). Applying PCR using these three primers, we confirmed that it is possible to differentiate among homozygous Hr(hr) (longer amplicons only), homozygous wild-type Hr(shorter amplicons only), and heterozygous (both amplicons) in HR and Hos:HR-1 mice. Our genomic analysis indicated that the HR, HRS/J, and Hos:HR-1 strains, and possibly Skh:HR-1 (an ancestor of Hos:HR-1) strain share the same Hr(hr) gene mutation. Our genotyping method will facilitate further research using hairless mice, and especially immature mice, because pups can be genotyped before their phenotype (hair coat loss) appears at about 2 weeks of age.

Genetic analysis of intestinal polyp development in Collaborative Cross mice carrying the Apc (Min/+) mutation

Background: Colorectal cancer is an abnormal tissue development in the colon or rectum. Most of CRCs develop due to somatic mutations, while only a small proportion is caused by inherited mutations. Familial adenomatous polyposis is an inherited genetic disease, which is characterized by colorectal polyps. It is caused by inactivating mutations in the Adenomatous polyposis coli gene. Mice carrying and non-sense mutation in Adenomatous polyposis coli gene at site R850, which designated Apc (R850X/+) (Min), develop intestinal adenomas, while the bulk of the disease is in the small intestine. A number of genetic modifier loci of Min have been mapped, but so far most of the underlying genes have not been identified. In our previous studies, we have shown that Collaborative Cross mice are a powerful tool for mapping loci responsible for phenotypic variation. As a first step towards identification of novel modifiers of Min, we assessed the phenotypic variation between 27 F1 crosses between different Collaborative cross mice and C57BL/6-Min lines.
Results: Here, C57BL/6-Min male mice were mated with females from 27 Collaborative cross lines. F1 offspring were terminated at 23 weeks old and multiple phenotypes were collected: polyp counts, intestine length, intestine weight, packed cell volume and spleen weight. Additionally, in eight selected F1 Collaborative cross-C57BL/6-Min lines, body weight was monitored and compared to control mice carry wildtype Adenomatous polyposis coli gene. We found significant (p < 0.05) phenotypic variation between the 27 F1 Collaborative cross-C57BL/6-Min lines for all the tested phenotypes, and sex differences with traits; Colon, body weight and intestine length phenotypes, only. Heritability calculation showed that these phenotypes are mainly controlled by genetic factors.
Conclusions: Variation in polyp development is controlled, an appreciable extent, by genetic factors segregating in the Collaborative cross population and suggests that it is suited for identifying modifier genes associated with Apc (Min/+) mutation, after assessing sufficient number of lines for quantitative trait loci analysis.

Genetic mapping of novel modifiers for ApcMin induced intestinal polyps' development using the genetic architecture power of the collaborative cross mice

Background: Familial adenomatous polyposis is an inherited genetic disease, characterized by colorectal polyps. It is caused by inactivating mutations in the Adenomatous polyposis coli (Apc) gene. Mice carrying a nonsense mutation in the Apc gene at R850, which is designated Apc^Min/+ (Multiple intestinal neoplasia), develop intestinal adenomas. Several genetic modifier loci of Min (Mom) were previously mapped, but so far, most of the underlying genes have not been identified. To identify novel modifier loci associated with Apc^Min/+, we performed quantitative trait loci (QTL) analysis for polyp development using 49 F1 crosses between different Collaborative Cross (CC) lines and C57BL/6 J-Apc^Min/+mice. The CC population is a genetic reference panel of recombinant inbred lines, each line independently descended from eight genetically diverse founder strains. C57BL/6 J-Apc^Min/+ males were mated with females from 49 CC lines. F1 offspring were terminated at 23 weeks and polyp counts from three sub-regions (SB1-3) of small intestinal and colon were recorded.
Results: The number of polyps in all these sub-regions and colon varied significantly between the different CC lines. At 95% genome-wide significance, we mapped nine novel QTL for variation in polyp number, with distinct QTL associated with each intestinal sub-region. QTL confidence intervals varied in width between 2.63-17.79 Mb. We extracted all genes in the mapped QTL at 90 and 95% CI levels using the BioInfoMiner online platform to extract, significantly enriched pathways and key linker genes, that act as regulatory and orchestrators of the phenotypic landscape associated with the Apc^Min/+ mutation.
Conclusions: Genomic structure of the CC lines has allowed us to identify novel modifiers and confirmed some of the previously mapped modifiers. Key genes involved mainly in metabolic and immunological processes were identified. Future steps in this analysis will be to identify regulatory elements - and possible epistatic effects - located in the mapped QTL.